HGVS-compliant variant descriptions

(alignment method = splign)

Type Variant description Links
Transcript (:c.) NM_139058.2:c.428_451dup
RefSeqGene (:g.) NG_008281.1:g.7382_7405dup
Predicted effect on protein (:p.) NP_620689.1:p.(Gly143_Ala150dup)
Predicted effect on protein (:p.) NP_620689.1:p.(G143_A150dup)
Variant description Genome Build: Chr: Pos: Ref: Alt Links
NC_000023.10:g.25031662_25031685dup GRCh37:X:25031660:G:GCGGCCGCGGCTGCCGCGGCGGCCC
NC_000023.11:g.25013545_25013568dup GRCh38:X:25013543:G:GCGGCCGCGGCTGCCGCGGCGGCCC

Recommended variant descriptions

View recommended variant descriptions in UCSC Genome Browser

  1. We recommend using a genomic and a transcript description in all publications
  2. We currently recommend that RefSeqGene descriptions should be used when possible

Genomic descriptions

Reference sequence type Variant description
RefSeqGene NG_008281.1:g.7382_7405dup
Chromosomal GRCh38 NC_000023.11:g.25013545_25013568dup

Transcript description(s)

Reference sequence type Variant description
RefSeq Transcript NM_139058.2:c.428_451dup

Transcript-level variants overlapping genome coordinates NC_000023.11:25013545_25013568


Genomic coordinates (VCF) with respect to genome build GRCh38

X-25013543-G-GCGGCCGCGGCTGCCGCGGCGGCCC


Aggregated data sources and clinical significance

VariantValidator

Select Genome Build
Alignment method: