HGVS-compliant variant descriptions

(alignment method = splign)

Type Variant description Links
Transcript (:c.) NM_000495.4:c.2550_2573del
RefSeqGene (:g.) RefSeqGene record not available RefSeqGene record not available
Predicted effect on protein (:p.) NP_000486.1:p.(Leu853_Gly860del)
Predicted effect on protein (:p.) NP_000486.1:p.(L853_G860del)
Variant description Genome Build: Chr: Pos: Ref: Alt Links
NC_000023.10:g.107863529_107863552del GRCh37:X:107863519:ATCCAGGACCTCCTGGACTTGATGT:A
NC_000023.11:g.108620299_108620322del GRCh38:X:108620289:ATCCAGGACCTCCTGGACTTGATGT:A

Recommended variant descriptions

View recommended variant descriptions in UCSC Genome Browser

  1. We recommend using a genomic and a transcript description in all publications
  2. We currently recommend that RefSeqGene descriptions should be used when possible

Genomic descriptions

Reference sequence type Variant description
RefSeqGene RefSeqGene record not available
Chromosomal GRCh38 NC_000023.11:g.108620299_108620322del

Transcript description(s)

Reference sequence type Variant description
RefSeq Transcript NM_000495.4:c.2550_2573del

Unable to provide variant descriptions with respect to the RefSeqGene sequence because:

  • No RefSeqGene has been created for the COL4A5 gene;
  • Or, Transcript NM_000495.4 has not been annotated in the RefSeqGene record for the COL4A5 gene

Transcript-level variants overlapping genome coordinates NC_000023.11:108620299_108620322


Genomic coordinates (VCF) with respect to genome build GRCh38

X-108620289-ATCCAGGACCTCCTGGACTTGATGT-A


Aggregated data sources and clinical significance

VariantValidator

Select Genome Build
Alignment method: